| p-value: | 1e-11 |
| log p-value: | -2.616e+01 |
| Information Content per bp: | 1.891 |
| Number of Target Sequences with motif | 108.0 |
| Percentage of Target Sequences with motif | 4.49% |
| Number of Background Sequences with motif | 32.0 |
| Percentage of Background Sequences with motif | 1.28% |
| Average Position of motif in Targets | 35.7 +/- 19.4bp |
| Average Position of motif in Background | 37.4 +/- 19.7bp |
| Strand Bias (log2 ratio + to - strand density) | 0.3 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
pan/dmmpmm(SeSiMCMC)/fly
| Match Rank: | 1 |
| Score: | 0.72 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --TCAAACTC TATCAAA--- |
|

|
|
pan/dmmpmm(Bigfoot)/fly
| Match Rank: | 2 |
| Score: | 0.71 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -TCAAACTC ATCAAA--- |
|

|
|
exd/MA0222.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.70 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TCAAACTC TGTCAAAN-- |
|

|
|
pan/dmmpmm(Papatsenko)/fly
| Match Rank: | 4 |
| Score: | 0.69 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TCAAACTC ATCAAAG-- |
|

|
|
exd/dmmpmm(Noyes_hd)/fly
| Match Rank: | 5 |
| Score: | 0.69 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----TCAAACTC NTTGTCAAAN-- |
|

|
|
STE12/MA0393.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.69 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TCAAACTC TGAAACA- |
|

|
|
SUT2/MA0400.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.67 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---TCAAACTC--------- ATGATAAACTCCGAAAATTT |
|

|
|
pan/dmmpmm(Pollard)/fly
| Match Rank: | 8 |
| Score: | 0.67 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --TCAAACTC GATCAAAG-- |
|

|
|
STE12/STE12_Alpha/92-STE12(Harbison)/Yeast
| Match Rank: | 9 |
| Score: | 0.65 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TCAAACTC TGAAACA- |
|

|
|
STE12(MacIsaac)/Yeast
| Match Rank: | 10 |
| Score: | 0.65 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TCAAACTC TGAAACA- |
|

|
|