| p-value: | 1e-8 |
| log p-value: | -2.070e+01 |
| Information Content per bp: | 1.818 |
| Number of Target Sequences with motif | 90.0 |
| Percentage of Target Sequences with motif | 6.18% |
| Number of Background Sequences with motif | 27.4 |
| Percentage of Background Sequences with motif | 1.88% |
| Average Position of motif in Targets | 41.2 +/- 19.7bp |
| Average Position of motif in Background | 28.6 +/- 18.5bp |
| Strand Bias (log2 ratio + to - strand density) | -0.0 |
| Multiplicity (# of sites on avg that occur together) | 1.01 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
MAFG::NFE2L1/MA0089.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.71 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TCATCKTG GTCATN--- |
|

|
|
TOD6/MA0350.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.68 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TCATCKTG---- AGGCACAGCTCATCGCGTTTT |
|

|
|
eve/dmmpmm(Bigfoot)/fly
| Match Rank: | 3 |
| Score: | 0.66 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TCATCKTG TAATTGTG |
|

|
|
skn-1/MA0547.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.66 |
| Offset: | -5 |
| Orientation: | reverse strand |
| Alignment: | -----TCATCKTG-- AATTGTCATCATTTT |
|

|
|
Atf3/MA0605.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.65 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---TCATCKTG ACGTCATC--- |
|

|
|
DOT6/MA0351.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.65 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TCATCKTG---- TTCTGCACCTCATCGCATCCT |
|

|
|
YY1/MA0095.2/Jaspar
| Match Rank: | 7 |
| Score: | 0.64 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----TCATCKTG GCNGCCATCTTG |
|

|
|
ESR1/MA0112.3/Jaspar
| Match Rank: | 8 |
| Score: | 0.63 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----TCATCKTG----- CAGGTCACCGTGACCTT |
|

|
|
MATA1(MacIsaac)/Yeast
| Match Rank: | 9 |
| Score: | 0.63 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | TCATCKTG- --ATTGTGC |
|

|
|
HMRA1/MA0327.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.63 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | TCATCKTG- --ATTGTGC |
|

|
|