| p-value: | 1e-4 |
| log p-value: | -1.054e+01 |
| Information Content per bp: | 1.803 |
| Number of Target Sequences with motif | 35.0 |
| Percentage of Target Sequences with motif | 4.72% |
| Number of Background Sequences with motif | 7.6 |
| Percentage of Background Sequences with motif | 1.14% |
| Average Position of motif in Targets | 34.8 +/- 20.2bp |
| Average Position of motif in Background | 36.5 +/- 16.8bp |
| Strand Bias (log2 ratio + to - strand density) | 0.4 |
| Multiplicity (# of sites on avg that occur together) | 1.13 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
NRG1/NRG1_H2O2Hi/[](Harbison)/Yeast
| Match Rank: | 1 |
| Score: | 0.81 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | AGGGACCG AGGGTCC- |
|

|
|
NRG1(MacIsaac)/Yeast
| Match Rank: | 2 |
| Score: | 0.78 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | AGGGACCG AGGGTCC- |
|

|
|
TCP5/MA1067.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.75 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | AGGGACCG- -GGGACCAC |
|

|
|
PCF5(TCP)/Oryza sativa/AthaMap
| Match Rank: | 4 |
| Score: | 0.75 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -AGGGACCG- NNGGGACCAC |
|

|
|
ARALYDRAFT_496250/MA1096.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.73 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | AGGGACCG- -GGGACCAC |
|

|
|
NRG1/MA0347.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.71 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------AGGGACCG----- CTAGATCAGGGTCCATCGCA |
|

|
|
PRDM14(Zf)/H1-PRDM14-ChIP-Seq(GSE22767)/Homer
| Match Rank: | 7 |
| Score: | 0.70 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----AGGGACCG GGTTAGAGACCT |
|

|
|
PHD1(MacIsaac)/Yeast
| Match Rank: | 8 |
| Score: | 0.70 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | AGGGACCG AGGCAC-- |
|

|
|
TCP4/MA1035.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.70 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | AGGGACCG- -GGGACCAC |
|

|
|
RTG3/Literature(Harbison)/Yeast
| Match Rank: | 10 |
| Score: | 0.68 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | AGGGACCG -GTGACC- |
|

|
|