| p-value: | 1e-1 |
| log p-value: | -4.279e+00 |
| Information Content per bp: | 1.856 |
| Number of Target Sequences with motif | 87.0 |
| Percentage of Target Sequences with motif | 5.51% |
| Number of Background Sequences with motif | 63.3 |
| Percentage of Background Sequences with motif | 3.84% |
| Average Position of motif in Targets | 37.4 +/- 19.4bp |
| Average Position of motif in Background | 38.1 +/- 21.2bp |
| Strand Bias (log2 ratio + to - strand density) | -0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.38 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
SPT15/MA0386.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.90 |
| Offset: | -5 |
| Orientation: | reverse strand |
| Alignment: | -----ATATATAT-------- NNNNAATATATATANCTANNN |
|

|
|
SeqBias: TA-repeat
| Match Rank: | 2 |
| Score: | 0.89 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -ATATATAT- TATATATATA |
|

|
|
Cf2/dmmpmm(Bergman)/fly
| Match Rank: | 3 |
| Score: | 0.87 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -ATATATAT TATATATAC |
|

|
|
Cf2/MA0015.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.86 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --ATATATAT NTATATATAC |
|

|
|
PB0080.1_Tbp_1/Jaspar
| Match Rank: | 5 |
| Score: | 0.84 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---ATATATAT----- TCTTTATATATAAATA |
|

|
|
TATA-box/SacCer-Promoters/Homer
| Match Rank: | 6 |
| Score: | 0.83 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | ATATATAT--- -TATATAWDVV |
|

|
|
MOT2/MA0379.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.82 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | ATATATAT --ATATA- |
|

|
|
PB0163.1_Six6_2/Jaspar
| Match Rank: | 8 |
| Score: | 0.79 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----ATATATAT----- ANNNGGATATATCCNNN |
|

|
|
NHP6A/MA0345.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.79 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------ATATATAT------ ATGACCTATATATAAAAATGA |
|

|
|
TBP(- other)/several species/AthaMap
| Match Rank: | 10 |
| Score: | 0.77 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -ATATATAT--- ACTATAAATACC |
|

|
|